Biomedical and Biotechnology Research Journal (BBRJ)

ORIGINAL ARTICLE
Year : 2022  |  Volume : 6  |  Issue : 3  |  Page : 326--336

Biological liquefaction and dehairing of tannery hides using protease crude extract from Bacillus safensis

Saranya Nachimuthu, Lavanya Nehru, Preethi Kathirvel 
 Department of Microbial Biotechnology, Bharathiar University, Coimbatore, Tamil Nadu, India

Correspondence Address:
Preethi Kathirvel
Department of Microbial Biotechnology, Bharathiar University, Coimbatore, Tamil Nadu
India

Abstract

Background: The contemporary usage of leather products has established large number of tanneries worldwide and increased the production of leather goods, releasing huge solid and liquid tannery waste. The amount of firm waste from the unprocessed skins and hides generated from tannery is increased day by day posing a solemn threat to the health and environment. It was reported to account 5-7% of the total solid wastes. This study aims for the biological approach of utilizing tannery hide waste for the production of bacterial enzymes. Proteases produced by the microbes have multiple commercial and industrial applications. Methods: The physiochemical property of raw trimming of bovine tannery hides was analyzed for the segregation of protease constructing bacteria. Seven bacterial isolates from the raw trimming bovine tannery hides were isolated and screened for their protease production and activity. The isolated bacterial strains were documented through morphological, biochemical tests and confirmed by MALDI-TOF and 16S rRNA sequencing as Bacillus safensis. Results: Among the seven isolates, Bacillus safensis established better proteolytic action. The culture conditions and media requirements were optimized for the maximum growth of the chosen bacteria. The crude proteolytic enzyme from Bacillus safensis was extracted, analyzed for its application in tannery hide dehairing activity through microbial fermentation. Further, the antibacterial and antioxidant properties displayed by the protease crude extract from Bacillus safensis could be explored for potential industrial and pharmaceutical applications. Conclusion: The verdict of the present study reveals a novel source of protease enzyme with the superior dehairing activity. Further, the research shed light on the strategies to reduce environmental pollution by the conversion of tannery waste into economically important products.


How to cite this article:
Nachimuthu S, Nehru L, Kathirvel P. Biological liquefaction and dehairing of tannery hides using protease crude extract from Bacillus safensis.Biomed Biotechnol Res J 2022;6:326-336


How to cite this URL:
Nachimuthu S, Nehru L, Kathirvel P. Biological liquefaction and dehairing of tannery hides using protease crude extract from Bacillus safensis. Biomed Biotechnol Res J [serial online] 2022 [cited 2023 Mar 26 ];6:326-336
Available from: https://www.bmbtrj.org/text.asp?2022/6/3/326/356162


Full Text



 Introduction



Leather industry plays an important role in the global economy as consumer usage has been increasing constantly. However, the accumulation of solid and liquid waste is unavoidable which emerges as one of the most polluting industrial sector.[1],[2] The industries involve a series of successive operations in the conversion of putrescible raw hides and skins of animals into stable nonputrescible leather products.[3],[4] Raw hides undergo several transformations including soaking, dehairing, and bating before production of the final leather product. Further, the multistep sequential process of the tanning industry involves pretanning, tanning and crusting, and refinishing operations.[5] Finally, using dyes, the hides are retanned for softening the leather product.[6],[7] These conversions involve tanning agents which in turn generate large quantities of solid waste, suspended solids including animal hair and trimmings, and highly turbid, colored, and foul-smelling liquid waste.[8] In addition, leather processing involves the usage of chemical reagents, which release a large amount of hazardous waste into the surrounding environment. It has been reported that trimming hides and raw skins from the tannery account for 5%–7% of the total solid wastes.[9]

The uncontrolled release of tannery solid and liquid wastes increases environmental pollution and serves as a potential threat to ecological crises and human beings.[8],[10] Further, during the processing of leather, varying quantities of trimmed hides and raw skins are disposed into the environment, which could cause deleterious impacts on human health.[11] The impact of the exposure to the chemicals used in tannery range from temporary effects to long-term impairments such as dizziness, irritation of eyes, bronchitis, ulcer, and genetic defects.[12]

The residual releases of tannery usually have high chromium content and have a high ability to penetrate human cells.[13] The chemical components present in the tannery waste invariably affect the growth and physiology of plants, germination of seeds, agriculture, and livestock.[14] Making use of tannery by-products by converting them into industrially useful products could be a dual solution to this problem. Enzymes are being successfully employed for the production of better-quality leather and the treatment of waste from the leather industry. Biomolecules can be efficiently generated from the wastes of the leather industry by chemical or biological methods. Since the chemical methods involve the use of hazardous chemicals and are not ecofriendly, biological methods attract attention in recent years.[15] Production of enzymes from the solid wastes of the tanning industry as a substrate serves as a viable technique for the recovery of byproducts.

Proteases, ubiquitous in nature, belong to the hydrolase family that hydrolyzes peptide bonds and play an important role in the metabolism of living organisms.[16] Proteases have also been widely used in industries including tannery and pharmaceuticals for the pretreatment of leather and formulation of therapeutic dietary products, respectively.[4] The enzyme can be obtained from diverse sources such as plants, animals, and microorganisms.[17]

The inability of the plant and animal proteases to meet the current industrial demands has increased special interest in microbial sources of proteases. Microorganisms represent a potential source of extracellular and intracellular enzyme production. A wide range of microorganisms including bacteria, molds, yeasts, and Actinomycetes produce proteases.[18] Microbial proteases account for about 40% of the total volume of enzymes produced worldwide[19] and possess most of the characteristics desired for biotechnological applications. Among the other bacterial species, extracellular proteases produced by Bacillus spp. play an important role in the biotechnological as well as industrial processes. The key applications of such proteases include the dehairing process in the leather industry and the additive of detergent formulation in the detergent industry. Most of the enzymes used in industrial applications are produced from a limited species of microorganisms. Studies have shown that protease enzyme production by bacteria can be influenced by nutritional factors including the sources of carbon and nitrogen. Fermentation medium could constitute the conducive environment in which the microorganisms multiply and carry out metabolic reactions efficiently.

Proteolytic and lipolytic enzymes are the key enzymes that are used in the leather industry to make the final consumer products. Enzymatic dehairing is being considered a safe process due to the reduced organic load released, reduced usage of harmful chemicals, and improved leather quality.[20] Protein and enzyme production using firm ravage as the substrate has been established as a feasible technique for by-product recovery.[21] Proteases are mainly used for the dehairing and dewooling process in the leather industry. The augmented practice of enzyme usage for dehairing and bating not only averts pollution but effectively saves energy. The extracellular proteases play an imperative role in both degradative conversion and synthetic functions. Among the other bacterial species, the extracellular proteases produced by Bacillus sp. carry commercial importance as their industrial applications are remarkable. Thus, the current study is aimed at the production of industrially useful proteases from the microorganism of tannery waste, which can be effectively applied in the tannery processes as well as other biotechnological industries.

 Methods



Sample collection

The unrefined flourishes of bovine hides were aseptically collected from E.K.M. Leather Processing Company, Private Limited, Erode, Tamil Nadu, India [Figure 1]a. The samples were transferred into clean, dry, and sterile bottles and transported to the laboratory for further processing [Figure 1]b.{Figure 1}

Type of the sample and reasons for selection

  1. Type of the sample: Sample used for this study is a raw trimming bovine tannery hides from tannery industry
  2. Reasons for selection: The FAO publications reveal that bovine contributes a maximum share of raw hides for leather production among other species
  3. The reports of FAO state that 18,704 million sq.ft. of leather is being produced globally, and China, India, Italy, and Korea produce large quantities of leather (4000, 1119, 2039, and 1090 million sq.ft., respectively) in 2006 among the major leather-producing countries
  4. The toxic waste discharge from the tannery is classified into three major categories solid waste, liquid waste, and emissions, which are of greater concern despite the economic importance of the tannery industry
  5. The process of dehairing, liming, deliming, bating, and finishing emits 108 m3 of gas into the air per ton of raw hides as a result of gas combustion (FAO Publications Catalogue 2021, 2021). The toxic waste products could potentially interact with the biota of environmental strata, exert deleterious impacts, affect the quality of the elements of the environment, and hamper biodiversity.
  6. The biodegradable organic matter is removed by the aerobic biological treatments, which is considered a secondary treatment process. Biological treatments primarily involve aerobic microorganisms, which metabolize organic waste into inorganic products
  7. Socking of rawhides in specific time duration , is necessary to make dehairing which resulted in durable leather. The conventional agents used for dehairing are a mix of a huge amount of sodium sulfide/hydrosulfide and lime
  8. Recycling the spent floats of dehairing and liming greatly reduces the resultant pollution load, i.e., 70% of sulfate, calcium hydroxide (93%), biological oxygen demand (7%), and chemical oxygen demand (26%)
  9. This is the reason why this study focuses on dehairing using extracelluar microorganism isolated from raw trimming bovine tannery hides.


Deliming process

The collected bovine hides were limed for storage purposes in the industries, and thus, deliming of the samples was necessary for further use [Figure 1]c. The hides were soaked in ammonium chloride (1.25% w/w) for 3–4 h to eradicate the adsorbed calcium salts. The deemed hides were perched in water for 1–2 h at neutral pH, cut into pieces of approximately 1.0 cm dimension, and stored in air-tight containers at 4°C for further experimental purposes.[22],[23],[24]

Physiochemical analysis of bovine tannery hides

The physiochemical parameters of the limed and delimed bovine hide samples such as pH, odor, appearance, electrical conductivity, biochemical oxygen demand (BOD), chemical oxygen demand (COD), total dissolved solids, total suspended solids, total hardness, chloride, sodium, and calcium were analyzed.[25]

Isolation of bacterial strain

The delimed hide samples were subjected to room temperature for bacterial isolation by the direct plating method [Figure 2]. The section was dot inoculated on the facade of nutrient agar plates and incubated at 37°C for 24–48 h. The observed results were confirmed by performing triplicates.[26]{Figure 2}

Screening for protease activity

The secluded bacterial colonies were screened for the protease enzyme construction on a sterile skim milk agar medium.[23] A loopful of isolated bacterial culture was inoculated aseptically and incubated at 37°C for 24–48 h to authenticate protease production at the source of the clear zone of hydrolysis.[27],[28] The result was confirmed by performing triplicates.

Screening for highest protease producer

The protease-producing bacterial strains were inoculated onto Erlenmeyer flasks comprising 150 mL of protease production broth with 0.5% cottonseed, 0.75% tamarind seed powder, 0.75% (w/v), salt solution, 5% (v/v) (MgSo4.7H2O, 0.5% [w/v]; KH2PO4 0.5% [w/v]), and FeSo4.7H2O, 0.01% (w/v) at 160 rpm at 37°C for 52 h.[29] The pH of the medium was adjusted to 7. Samples were introverted at customary intervals of every 4 h up to 52 h of growth. The bacterial escalation of every 4-h sample was assessed by turbidity measurement at 600 nm. Each sample was centrifuged at 10,000 rpm at 4°C for 20 min, and cell-free supernatant was collected and used for crude enzyme extract grounding.[30]

Quantitative analysis of protease activity

The protease commotion was quantitatively analyzed by a faintly modified technique as described by Verma and Baiswar.[30] The assay mixture comprising 1.0 mL of crude enzyme extract and 2.0 mL casein (15% [w/v] in 20 mM borate buffer, pH 7) was incubated at 37°C for 20 min. The assay mixture was supplemented with 4.0 mL of trichloroacetic acid to impede the reaction, vortexed, and incubated in advance for 15 min at room temperature. The contents were centrifuged at 10,000 rpm for 15 min, the supernatant was spectrophotometrically examined, and the quantification of free tyrosine released by Lowry's method was analyzed using the tyrosine standard.[31] The unit of protease activity was expressed as the amount of enzyme required to liberate 1.0 μg of tyrosine per min per mL under standard assay conditions.

Bacterial strain selection and identification

The isolated bacterial strain showing maximum proteolytic zone was recognized based on Bergey's Manual of Determinative Bacteriology[32] and subjected to morphological and biochemical analysis.

Molecular identification and phylogenetic analysis

The bacterial strain was identified using its peptidic spectra through MALDI-TOF. A single bacterial colony was picked and deposited onto the MALDI-TOF target plate, overlaid by matrix solution (2 μL saturated solution of α-cyano-4-hydroxycinnamic acid in acetonitrile [50%] and tri-fluoro acetic acid [2.5%]), and identified by Bruker Daltonik MALDI Biotyper (Leipzig, Germany) rigged with a nitrogen laser (337 nm). Data were analyzed using Biotyper software (version 2.0), Leipzig, Germany where spectra of isolates were pattern matched against the reference spectra database.[33]

The genomic DNA was isolated from the preferred bacterial strain and subjected to partial sequencing of 16S rRNA.[34] Polymerase chain reaction (PCR) amplifies the isolated genomic DNA sequence using the primers 27F (5'AGAGTTGATCTGGCTCAG 3') and 1492R (5' TACGGTACCTTGTTACGACTT 3') number base 20 (Edgar RC: MUSCLE). PCR reaction solution included 1.5 μL of forward primer and reverse primer, 5 μL of deionized water, and 12 μL of Taq Master Mix. PCR intensification was executed as follows: initial denaturation at 95°C for 2 min, 50°C of annealing, and final extension at 72°C for 10 min. The PCR product was rinsed out in Montage PCR Clean-up kit (Millipore). The PCR artifact was sequenced using the primers. Sequencing reactions were achieved using an ABI PRISM® BigDye™ Terminator Cycle Sequencing Kits with AmpliTaq® DNA polymerase (FS enzyme) (Applied Biosystems). Sequencing was achieved on each template using below 16s rRNA universal primers. The fluorescent-labeled fragments were purified from the unincorporated terminators with ethanol precipitation etiquette. The sequences were evaluated with the known sequences in the Gene Bank nucleotide database, and the species level was branded as the nearest phylogenetic neighbor with >99% sequence similarity.[35]

Media optimization for growth and production of proteolytic bacteria

The basal media (cottonseed 0.5% [w/v], tamarind seed powder 0.75% [w/v], salt solution, 5% [v/v] – [MgSO4.7H2O, 0.5% (w/v); KH2PO4 0.5% (w/v)], and FeSO4.7H2O, 0.01% [w/v]) were used for the production of protease subjected to optimization with respect to different cultural parameters, including the temperature (30°C, 37°C, 44°C, 51°C), pH,[6],[7],[8],[9] incubation period (24 h, 48 h, 72 h, and 96 h), and organic carbon (rice husk, cottonseed, banana peel, sugarcane molasses) and organic nitrogen (rabbit manure, coconut oil cake, eggshell, tamarind seed powder) sources for the maximum enzyme production as described.[36]

Fermentation of raw trimming hide solid waste with protease activity

The delimed tannery hide of approximately 10 g of 1 cm size was taken for modified dehairing activity[37] and added 50 mL of standard media containing 1% of the protease crude extract from the isolated high yielding strain.[13] The experimental setup was kept in shaking condition at 37°C for 5 days and was monitored at every 24 h. The control flask was maintained without protease extract. The fermented broth was centrifuged at 5000 rpm at 4°C to separate the removed hairs from the hide at every 24 h interval.

Antibacterial activity

Antibacterial activity of protease crude extract was determined by agar well diffusion as described by Balakrishnan et al.[38] Freshly prepared Mueller–Hinton agar plates were swabbed with two different species of Gram-negative bacteria, namely, Klebsiella pneumoniae and Escherichia coli. Wells of around 6 mm diameter were made in the Petri plates using a sterile cork borer. Isolated protease crude extract from the delimed trimmed rawhides was incubated at 37°C for 18–24 h to observe antagonistic zones. Chloramphenicol was used as a positive control. The diameter of the zone of inhibition was measured.

Antioxidant activity

The antioxidant property of protease crude extract was analyzed using the DPPH radical scavenging assay and superoxide radical scavenging assay described by Brand-Williams et al.,[39] as Hyland et al.,[40] respectively. The isolated protease crude extract (100μl) was added to the tube which containing 3.9 ml of 60 μM DPPH diluted in ethanol. Then, it was incubated for 30 min in the dark and the absorbance was measured at 517 nm. For the superoxide radical scavenging activity analysis, the protease crude extract of 600 μL at various concentrations (1, 2, 3, 4, and 5 mg/mL) was added to the tube containing 200 μL of nitroblue tetrazolium (NBT) (1 mg/mL of DMSO) and 2 mL of alkaline DMSO (1 mL DMSO containing 5 mM NaOH in 0.1 ml H2O) making the final volume 2.8 mL, and the absorbance was measured at 560 nm.

 Results



Physiochemical parameters of bovine tannery hides

The physiochemical parameters of the raw trimmed bovine hide were analyzed before and after deliming process presented along with the permissive limits [Table 1]. The results showed that all the parameters were within the Indian standard limits and hence could be used for further studies.{Table 1}

Bacterial isolation

The bovine hide samples were dot inoculated on the nutrient agar plates, and after 24 h of incubation, bacterial colonies were observed on the surface of the agar plates [Figure 2]a. The obtained colonies were white-colored and yellow-colored [Table 2]. They were subcultured and maintained.{Table 2}

Screening of bacteria for the protease activity

Bacterial colonies were screened for the protease enzyme production on skim milk agar plates which showed positive results in the presence of a zone of hydrolysis [Figure 2]b.

Screening for highest protease producer

All the seven bacterial isolates (strain 1p, 2p, 3p, 4p, 5p, 6p, and 7p) were analyzed for protease production and the activity was monitored every 4 h of interval for 52 h. All the isolates produced protease enzyme as shown in [Table 3]. The strain 5p produced the highest enzyme production of about 416 U/mL and the next highest production was by 4p of about 378 U/mL. Hence, the high yield strain 5p was considered for further application studies.{Table 3}

The growth curve pattern of all the seven isolates showed that the extracellular protease production was minimum at lag and log phase and the maximum production was obtained at the stationary phase [Figure 3]a. The strain 5p produced 416 U/mL at 44 h, and the activity declined after 44 h of incubation; similarly, strain 4p also yielded its maximum enzyme units of 378 U/mL and then started to decline. This suggested that proteases were largely formed during the stationary phase of growth.{Figure 3}

Bacterial strain identification

Based on the above results, strain 5p had the highest protease production and was taken for further analysis. The morphological [Figure 3]b characterization of bacteria under microscopy after Gram staining shows a rod-shaped purple color appearance. This reveals that the bacteria are rod-shaped Gram-positive bacteria [Table 4]. The biochemical tests suggested that strain 5p has catalase and oxidase activity. It also can act on casein, gelatin, sucrose, and fructose and is motile. Further phylogenetics analysis is confirmed with its species level.{Table 4}

Molecular identification and phylogenetic analysis

The MALDI-TOF identified the strain as Bacillus pumilus with a score value of 1.81 [Table 5]. The score falls within the range of 1.7–2.0 showing the resolution at the genus level. In addition, 1.81 score identifies the sample at the genus level. This confirms the bacteria at genus level as Bacillus sp.{Table 5}

The isolated strain 5p was further subjected to 16s rRNA gene amplification. The sequence from the 16s rRNA gene was aligned to find their match. It has matched with 99.67% sequence similarity with the gene bank submission MN889857 [Table 6], and a phylogenic tree was generated based on the sequence information. Thus, the 16s rRNA identified a similar genus as identified by biochemical assays and MALDI-TOF and further identified at the species level. The pattern of branching in a phylogenetic tree reflected how species or other groups evolved from a series of common intimates [Figure 3]c.{Table 6}

Media optimization for growth and production of proteolytic bacteria

The optimal condition for high protease production varies with pH, temperature, inoculum size, carbon source, nitrogen source, and incubation period. A wide range of pH was taken to assess the bacteria growth from pH 6–9 [Figure 4]a. The pH 7 exhibited a maximum activity with 412 U/mL and optimal pH of around 7.4. The second parameter Temperature was analyzed at 30°C, 37°C, 44°C, and 51°C [Figure 4]a. 37°C showed a significant change in the range of 396 U/mL. Among the nitrogen sources, tamarind seed powder showed the maximum growth and protease production of 386 U/mL [Figure 4]b. Among carbon sources used, cottonseed had shown a significant effect with a maximum activity of 420 U/mL [Figure 4]b. Incubation periods are maximum in the range of 48 h. Inoculums size is best at 1% [Figure 4]c, and this is reported as optimum inoculum size for Bacillus sp. for protease production.{Figure 4}

Fermentation of raw trimming hide solid waste with proteolytic bacteria

Dehairing activity

The efficiency of dehairing activity of the protease crude extract obtained from Bacillus safensis was analyzed on the delimed hides. The protease enzyme extract was found to remove the hairs from the hides partially at 24 h of coincubation and completely at 48 h. Moreover, the hide was completely coagulated and liquefied in the fermented medium at 48 h [Figure 5].{Figure 5}

Antibacterial activity

The results observed were the different concentrations of protease crude enzyme extract showing growth inhibition zones on Muller–Hinton agar plates for Klebsiella pneumoniae and Escherichia coli. The zone of inhibition was measured and the results were interpreted as shown in [Figure 6]a, [Figure 6]b, [Figure 6]c, [Figure 6]d. The zones of inhibition were found to be 10–20 nm diameter and the E. coli was found to be sensitive toward the protease crude extract. Further, the diameter of the zone of inhibition was observed to be concentration-dependent.{Figure 6}

Antioxidant properties

The inhibition activity of protease crude enzyme extracts at different concentrations 1, 2, 3, 4, and 5 mg/mL was determined by using DPPH as standard. DPPH radical scavenging activity with the IC50 value of 4.20 mg corresponds to 38.7% inhibition. Superoxide radical scavenging activity of protease crude enzyme extract was determined by inhibition of NBT reduction using ascorbic acid as control. Superoxide radical scavenging activity with IC50 value of 5.56 mg corresponds to 26.2% inhibition. The results are shown in [Table 7] and [Figure 6]a, [Figure 6]b, [Figure 6]c,[Figure 6]d.{Table 7}

 Discussion



Tanneries are one of the age-old industries on the earth. Throughout the primeval times, tanning activities were geared up to the restricted demands of leather footwear, drums, and musical instruments. Increased inhabitants and higher consumer rates heaved the need for large-scale productions, leading to the establishment of vast marketable tanneries.[41] Still, it has been experiential that the leather industry is allied with environmental effluence due to the unrefined solid and liquid wastes and lofty water utilization during customary manufacturing processes.[23] The environmental bodies were devastated during the transformation of hides and skins into leathers in leather factories. In leather factories, solid waste comprises protein that constitutes more than 60% of rawhide weight and was willing to the environment exclusive of turning them into good exploit at the industrial plane. They also reported that a further, biological approach to protease production by diverse microorganisms was found to be the prominent way to utilize tannery proteinaceous solid waste. Khambhaty (2020) reported on the isolation, purification, and immobilization of the unambiguous enzymes required for favored function, at each stage of tanning.[42]

Enzymes have potential applications in agriculture, leather, food, textile, detergent, bioremediation, and pharmaceutical industries. It has been reported that modern trends use enzymatically enhanced dehairing processes with different enzymes such as proteases, lipases, and amylases in leather-processing units.[42],[43],[44] Usage of proteolytic enzymes in fabrication processes by various microorganisms has been widely reported, but Bacillus type is reported to exude a high quantity of protease for assorted commercial and industrial purposes.[45],[46],[47],[48] Yadav et al., (2019) reported that animal fleshing was the chief proteinous solid waste discharged from leather industries, which could be potentially used as the substrate for the production of alkaline protease by Pseudomonas aeruginosa.[49] Isolation of suitable bacterium for protease production has also been screened by skim milk agar plate and further confirmed by protease production assay.[28]

They also identified Bacillus cereus FT 1 as the bacterial isolate showing the highest protease production by molecular methods. Further, it has been suggested that B. cereus produces the highest protease activity of 410 U/mL during the early stationary phase after 36 h of growth.[30] In the present study, we report that B. safensis produces a maximum quantity of protease, about 416 U/mL at 44 h of growth through the stationary phase which complies with the findings of Verma and Baiswar.[30]

The chosen microorganism showed maximum growth at pH 7.0 and a temperature of 37°C, which suggests that the organism does not require specialized culture conditions. Further, tamarind seed coat and cottonseed have shown to be excellent sources of nitrogen and carbon sources, respectively, which are economically less expensive resources. Recent findings suggest that the use of enzymes for the dehairing process has many advantages over conventional and chemical methods.[50] It has also been reported that enzyme-based dehairing is an ecofriendly option that reduces nearly 40% of BOD and 50% of COD in leather processing.[26] In the current investigation, treatment after 18 h of incubation dehairing was manually done by protease produced from the microorganisms. This enzyme is accounted as nonkertinolytic and noncollagenolytic. In the current study, crude protease extract of B. safensis was used to dehair the delimed hides in 48 h of incubation and also observed that the enzyme utterly coagulates the collagen particle of delimed hide and forms a liquefied in the fermented medium. Further, the protease crude extract has been shown to possess potential antibacterial activity, which could be explored in other industries and pharmaceutical applications. In addition, antioxidant-scavenging properties displayed by the isolated protease crude extract from the trimmed rawhide suggest that the significance of the bacterial strain could open new avenues for industrial applications.

 Conclusion



In the present study, tannery bovine hide was used for the isolation of proteolytic bacteria and the organism was identified as B. safensis through 16S rRNA sequencing and phylogenetic tree analysis. The strain B. safensis was preferred for further study based on its ability to produce high protease content and better activity. Conducive environment and growth media for the bacteria were optimized for maximum growth. The bacterial growth curve was achieved with maximum enzyme production at 36 h in the stationary phase followed by growth curve refuse. The fermentative approach of the dehairing activity of bovine hides using extracellular protease crude extract of B. safensis showed to be a promising entrant. The enzyme potentially removes the hair completely and the delimed hide was liquefied. Thus, this property of enzyme could be potentially demoralized for auxiliary use in tanneries and the resulting goods can be worn in the agricultural field as biofertilizers. Furthermore, the protease from the strain could be an excellent alternative source since it possesses antibacterial and antioxidant activity.

Limitation of the study

  1. I have chosen the 5p strain for my dehairing application study because it produces high protease activity compared with other strain
  2. Protease crude extract obtained from B. safensis was analyzed for dehairing activity of delimed hides whether the extract is ecofriendly
  3. It is time consumable, compared to the enzymatic treatment
  4. Zero chemical usage in dehairing process
  5. Meanwhile, the crude extract obtained from B. safensis further used as a liquid fertilizer for plant study and is also easy to use in plant weather in spraying method.
  6. Economically feasible treatment in low cost-effective.
  7. Comparative with chemical dehairing treatment, making use of tannery by products by converting them into industrially useful products
  8. Bacillus species has the extracellular protease production, and it is a commercial importance as their industrial application in tannery industry.


Acknowledgment

Author N. Saranya would like to express our heartfelt thanks to the Rashtriya Uchchatar Shiksha Abhiyan (RUSA 2.0-BEICH), Government of India, Bharathiar University for the financial support throughout the project. Grant number: IQAC/RUSA2.0/PF/2020/1 dated February 3, 2020.

Financial support and sponsorship

The study was financially supported by Rashtriya Uchchatar Shiksha Abhiyan (RUSA 2.0-BEICH), Government of India, Bharathiar University, throughout the project. Grant number: IQAC/RUSA2.0/PF/2020/1 dated February 3, 2020.

Conflicts of interest

There are no conflicts of interest.

References

1Ravindran B, Lee SR, Chang SW, Nguyen DD, Chung WJ, Balasubramanian B, et al. Positive effects of compost and vermicompost produced from tannery waste-animal fleshing on the growth and yield of commercial crop-tomato (Lycopersicon esculentum L.) plant. J Environ Manage 2019;234:154-8.
2Chowdhury M, Hossain I, Deb AK, Biswas TK. Removal of toxicants from leather industrial wastewater using sawdust filter media and ferric oxide (Fe2O3) coagulant. Orient J Chem 2019;35:597.
3Senthil Kumar P, Janet Joshiba G. Environmental and Chemical Issues in Tanneries and Their Mitigation Measures. In: Leather and Footwear Sustainability. Springer, Singapore; 2020:1-10.
4Ayele M, Limeneh DY, Tesfaye T, Mengie W, Abuhay A, Haile A, Gebino G. A Review on Utilization Routes of the Leather Industry Biomass. Adv Mater Sci Eng 2021;01-15.
5Yuvaraj A, Karmegam N, Ravindran B, Chang SW, Awasthi MK, Kannan S, Thangaraj R Recycling of leather industrial sludge through vermitechnology for a cleaner environment—A review. Ind Crops Prod 2020;155:112791.
6Covington AD, Wise WR. Current trends in leather science. J Leather Sci Eng 2020;2:1-9.
7Zhao C, Chen W. A review for tannery wastewater treatment: Some thoughts under stricter discharge requirements. Environ Sci Pollut Res Int 2019;26:26102-11.
8Tasca AL, Puccini M. Leather tanning: Life cycle assessment of retanning, fatliquoring and dyeing. J Clean Prod 2019;226:720-9.
9Yoseph Z, Christopher JG, Demessie BA, Selvi AT, Sreeram KJ, Rao JR. Extraction of elastin from tannery wastes: A cleaner technology for tannery waste management. J Clean Prod 2020;243:118471.
10Koppiahraj K, Bathrinath S, Saravanasankar S. Leather waste management scenario in developed and developing nations. Int J Eng Adv Technol 2019;9:852-7.
11Arora A, Kaul B, Singh A. Multiple peroneal nerve abscesses: The first presentation of borderline tuberculoid leprosy. Biomed Biotechnol Res J 2018;2:159.
12Habeeb AA, EL-Tarabany AA. Impact of environmental pollution on healthy and productivity of farm animals. Am Int J Multidiscip Sci Res 2018;1:17-25.
13Oruko RO, Selvarajan R, Ogola HJ, Edokpayi JN, Odiyo JO. Contemporary and future direction of chromium tanning and management in sub Saharan Africa tanneries. Process Saf Environ Prot 2020;133:369-86.
14Kadhim FH, Mohammed SH. Microbiological profile, antibiogram, and risk factors of patients with diabetic foot infections: A systemic metaanalysis. Biomed Biotechnol Res J 2021;5:235.
15Shafquat Y, Shaheen G, Qamar F, Shakoor S. Comparison of two methods for direct susceptibility testing of Salmonella typhi and Salmonella paratyphi a from blood cultures in a high-burden laboratory setting. Biomed Biotechnol Res J 2019;3:131.
16Ahmed R, Ganguli P, Singh N, Singh S, Gupta UD, Jaiswal YK, et al. Establishing reference ranges and normal values for coagulation screening in healthy Indian male volunteers enrolled for a longitudinal study. Biomed Biotechnol Res J 2019;3:22.
17Singh RS, Singh T, Pandey A. Microbial enzymes—an overview. Adv Enzym Technol. Published online 2019:1-40.
18Palla MS, Guntuku GS, Muthyala MK, Pingali S, Sahu PK. Isolation and molecular characterization of antifungal metabolite producing actinomycete from mangrove soil. Beni Suef Univ J Basic Appl Sci 2018;7:250-6.
19Singh R, Singh A, Sachan S. Enzymes used in the food industry: friends or foes? In: Enzymes in Food Biotechnology. Elsevier, Academic Press; 2019:827-843.
20Kanagaraj J, Panda RC, Kumar V. Trends and advancements in sustainable leather processing: Future directions and challenges – A review. J Environ Chem Eng 2020;8:104379.
21Ahmad S, Ali MA, Aita GM, Khan MT, Khan IA. Source-sink relationship of sugarcane energy production at the sugar mills. In: Sugarcane Biofuels. Springer, Cham; 2019:349-88.
22Ganesh Kumar A, Swarnalatha S, Sairam B, Sekaran G. Production of alkaline protease by Pseudomonas aeruginosa using proteinaceous solid waste generated from leather manufacturing industries. Bioresour Technol 2008;99:1939-44.
23Ahmad J, Ansari TA. Alkaline protease production using proteinaceous tannery solid waste. J Pet Env Biotechnol 2013;4:01-04.
24Watanabe K, Hayano K. Estimate of the source of soil protease in upland fields. Biol Fertil Soils 1994;18:341-6.
25Chatterjee J, Giri S, Maity S, Sinha A, Ranjan A, Gupta S. Production and characterization of thermostable alkaline protease of Bacillus subtilis (ATCC 6633) from optimized solid-state fermentation. Biotechnol Appl Biochem 2015;62:709-18.
26Senthilvelan T, Kanagaraj J, Mandal AB. Application of enzymes for dehairing of skins: Cleaner leather processing. Clean Technol Environ Policy 2012;14:889-97.
27Jani SA, Parekh YM, Parmar TN, Dalwadi TJ, Patel HB, Parmar SK. Screening and characterization of alkaline protease producing Bacillus strain B-4 Bacillus flexus and study of its potential for alkaline protease production. Int J Curr Microbiol Appl Sci 2016;5:767-87.
28Asha B, Palaniswamy M. Optimization of alkaline protease production by Bacillus cereus FT 1isolated from soil. J Appl Pharm Sci 1930;8:119-27.
29Lakshmi BK, Sri PR, Devi KA, Hemalatha KP. Media optimization of protease production by Bacillus licheniformis and partial characterization of alkaline protease. Int J Curr Microbiol Appl Sci 2014;3:650-9.
30Verma T, Baiswar V. Isolation and characterization of extracellular thermoalkaline protease producing Bacillus cereus isolated from tannery effluent. Int J Environ Sci 2013;2:23-9.
31Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem 1951;193:265-75.
32Buchanan RE, Gibbons NE. Bergey's Manual of Determinative Bacteriology 8ed. The Williams and Wilkins Co., Baltimore; 1974.
33Seng P, Drancourt M, Gouriet F, La Scola B, Fournier PE, Rolain JM, et al. Ongoing revolution in bacteriology: Routine identification of bacteria by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Clin Infect Dis 2009;49:543-51.
34Edwards U, Rogall T, Blöcker H, Emde M, Böttger EC. Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. Nucleic Acids Res 1989;17:7843-53.
35Castresana J. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol 2000;17:540-52.
36Mhamdi S, Haddar A, Mnif IH, Frikha F, Nasri M, Kamoun AS. Optimization of protease production by Bacillus mojavensis A21 on chickpea and faba bean. Adv Biosci Biotechnol 2014;5:1049.
37Thazeem B, Umesh M, Mani VM, Beryl GP, Preethi K. Biotransformation of bovine tannery fleshing into utilizable product with multifunctionalities. Biocatal Biotransformation 2021;39:81-99.
38Balakrishnan B, Prasad B, Rai AK, Velappan SP, Subbanna MN, Narayan B. In vitro antioxidant and antibacterial properties of hydrolysed proteins of delimed tannery fleshings: Comparison of acid hydrolysis and fermentation methods. Biodegradation 2011;22:287-95.
39Brand-Williams W, Cuvelier ME, Berset C. Use of a free radical method to evaluate antioxidant activity. LWT Food Sci Technol 1995;28:25-30.
40Hyland K, Voisin E, Banoun H, Auclair C. Superoxide dismutase assay using alkaline dimethylsulfoxide as superoxide anion-generating system. Anal Biochem 1983;135:280-7.
41Durai G, Rajasimman M, Rajamohan N. Kinetic studies on biodegradation of tannery wastewater in a sequential batch bioreactor. J Biotech Res. 2011;3:19.
42Khambhaty Y. Applications of enzymes in leather processing. Environ Chem Lett 2020;18:747-69.
43Maharaja P, Boopathy R, Anushree VV, Mahesh M, Swarnalatha S, Ravindran B, et al. Bio removal of proteins, lipids and mucopolysaccharides in tannery hyper saline wastewater using halophilic bacteria. J Water Process Eng 2020;38:101674.
44Fasim A, More VS, More SS. Large-scale production of enzymes for biotechnology uses. Curr Opin Biotechnol 2021;69:68-76.
45Kour D, Rana KL, Thakur S, Sharma S, Yadav N, Rastegari AA, et al. Disruption of protease genes in microbes for production of heterologous proteins. In: New and Future Developments in Microbial Biotechnology and Bioengineering. Elsevier, Academic Press; 2019:35-75.
46Popescu L, Bulgaru V, Siminiuc R. Effect of temperature, pH and amount of enzyme used in the lactose hydrolysis of milk. Food Nutr Sci 2021;12:1243-54.
47Navvabi A, Razzaghi M, Fernandes P, Karami L, Homaei A. Novel lipases discovery specifically from marine organisms for industrial production and practical applications. Process Biochem 2018;70:61-70.
48Soong YV, Sobkowicz MJ, Xie D. Recent advances in biological recycling of polyethylene terephthalate (PET) plastic wastes. Bioengineering (Basel) 2022;9:98.
49Yadav VK, Singh V, Mishra V. Alkaline protease: A tool to manage solid waste and its utility in detergent industry. In: Microbial Genomics in Sustainable Agroecosystems. Springer, Singapore; 2019:231-54.
50Kerouaz B, Jaouadi B, Brans A, Saoudi B, Habbeche A, Haberra S, et al. Purification and biochemical characterization of two novel extracellular keratinases with feather-degradation and hide-dehairing potential. Process Biochem. 2021;106:137-148.

 

 
Sunday, March 26, 2023
 Site Map | Home | Contact Us | Feedback | Copyright and Disclaimer