|
 
 |
| ORIGINAL ARTICLE |
|
| Year : 2023 | Volume
: 7
| Issue : 1 | Page : 93-100 |
|
Microbial isolation and characterization of arsenic degrading microbes from soil and its RAPD analysis for bioremediation
Kaushika Shanmugam1, Kalaivani Kumar1, Srinisha Abhimanyu2, Sri Sowmiya Selvaraju3, B Sri Lakshmi Narayana1, RS Sharanprasath4, T Naveen Kumar1, R Manikandan1, S Hari bala1
1 Department of Biotechnology, Karpagam Academy of Higher Education, Faculty of Engineering, Coimbatore, India
2 Department of Civil Engineering, Karpagam College of Engineering, Coimbatore, India
3 Department of Biotechnology, Rathinam Technical Campus, Coimbatore, India
4 Department of Biotechnology, Bannariamman Institute of Technology, Sathyamangalam, Erode, India
| Date of Submission | 02-Nov-2022 |
| Date of Decision | 19-Jan-2023 |
| Date of Acceptance | 20-Feb-2023 |
| Date of Web Publication | 14-Mar-2023 |
Correspondence Address:
Kalaivani Kumar
Department of Biotechnology, Faculty of Engineering, Karpagam Academy of Higher Education, Coimbatore, Tamil Nadu
India
 Source of Support: None, Conflict of Interest: None
DOI: 10.4103/bbrj.bbrj_330_22
The aim of this work is to isolate the microbes possessing arsenic degrading property from contaminated soil, collected from Cauvery River at Pallipalayam, Erode District. Six microbial strains were grown well in 40Mm sodium arsenate as a sole carbon source amended M9 minimal media. Based on the zone of clearance, three microbial strains were found to be potent arsenic degrading microbes and they are identified as Bacillus spp., Staphylococcus spp., and Pseudomonas spp. They may potentially be used in the bioremediation of arsenic and other contaminants. It infers that the presence of arsenate reductase (ArcC) gene in three of the microbial strain and they were taken for further studies. Genomic DNA isolation protocol was standardized and DNA isolation was performed. ArcC gene-specific primers were designed using Primer3 bioinformatics tool. Genetic diversity among the strains was studied by RAPD analysis using four different primers. Dendrogram was constructed using Unweighted Pair Group using Arithmetic Averages and NJ tools. The presence of genetic diversity was observed from the analysis. Polymerase chain reaction amplification and sequencing of amplified gene products are to be done in future.
Background: The aim of this work is to isolate the microbes possessing arsenic degrading property from contaminated soil, collected from Cauvery River at Pallipalayam, Erode District. Six microbial strains were grown well in 40Mm sodium arsenate as a sole carbon source amended M9 minimal media. Based on the zone of clearance, three microbial strains were found to be potent arsenic degrading microbes and they are identified as Bacillus spp., Staphylococcus spp., and Pseudomonas spp. They may potentially be used in the bioremediation of arsenic and other contaminants. It infers that the presence of arsenate reductase (ArcC) gene in three of the microbial strain and they were taken for further studies. Genomic DNA isolation protocol was standardized and DNA isolation was performed. ArcC gene-specific primers were designed using Primer3 bioinformatics tool. Genetic diversity among the strains was studied by RAPD analysis using four different primers. Dendrogram was constructed using Unweighted Pair Group using Arithmetic Averages and NJ tools.The presence of genetic diversity was observed from the analysis. Polymerase chain reaction amplification and sequencing of amplified gene products are to be done in future. Methods: The soil sample was collected from Cauvery River, Pallipalayam. Arsenate, arsenic bioremediation, arsenic reducing gene, RAPD, and genetic diversity were used. Results: With the dilution concentrations, 10−5 and 10−6 microbial population was obtained in M9 minimal media. From the pure colonies of isolates, TA1, TA2, TA4, and TA5 genomic DNA was extracted using the protocol mentioned above. The culture was inoculated in LB broth and kept in incubation at 37°C for overnight. From overnight culture, genomic DNA was extracted. RAPD analysis for the isolates was performed using four different random primers namely RBA-1, RBA-4, RBA-5, and RBA-6. Conclusion: Three of the isolates designated as TA2, TA4, and TA5 were found to be potent arsenic degarding microbes. They are able to degrade sodium arsenate of about 40mM. It infers that they can be potentially used in bioremediation of arsenic. Isolation of ArcC gene from the isolates is in progress. Sequencing will reveal the nature of amplified products. If the amplified genes are cloned and mass production of ArcC gene could be obtained.
Keywords: Arsenate, arsenic bioremediation, arsenic reducing gene, genetic diversity, RAPD
How to cite this article:
Shanmugam K, Kumar K, Abhimanyu S, Selvaraju SS, Narayana B S, Sharanprasath R S, Kumar T N, Manikandan R, bala S H. Microbial isolation and characterization of arsenic degrading microbes from soil and its RAPD analysis for bioremediation. Biomed Biotechnol Res J 2023;7:93-100 |
How to cite this URL:
Shanmugam K, Kumar K, Abhimanyu S, Selvaraju SS, Narayana B S, Sharanprasath R S, Kumar T N, Manikandan R, bala S H. Microbial isolation and characterization of arsenic degrading microbes from soil and its RAPD analysis for bioremediation. Biomed Biotechnol Res J [serial online] 2023 [cited 2023 Jun 10];7:93-100. Available from: https://www.bmbtrj.org/text.asp?2023/7/1/93/371694 |
| Introduction | |  |
Arsenic (As) is recognized as a poisonous metalloid that has the ability of having pentavalent and trivalent ions that can constrain various biochemical methods.[1],[2],[3],[4],[5],[6] The base for Arsenic in environmental is a derivative from several natural sources such as marine sedimentary rocks, weathered volcanic, minerals, fossil fuels, air, water, living organisms, and anthropogenic events with chemicals such as pesticides, herbicides, mining, preservatives for wood, therapeutic products, and manufacturing activities.[5],[7],[8] Arsenic trioxide is widely used in the treatment of cancer.[9] Owing to its poisonous properties, the manufacture of antimicrobial agents is been exploited, for example is Salvorsan 606, the first precise antibiotic and the Melarsen drug for African sleeping sickness. As an outcome, arsenic compounds are present in soils, plants, animals, and humans. Like arsenate, plants have the capability to take up arsenite from soils. Arsenite is normally exhibiting extratoxic property than arsenate, and together arsenite and arsenate are additionally toxic than organic “Arsenic” compounds. Exposure of Arsenic causes a diversity of health difficulties such as neuropathies, anemia, hyperpigmentation, and irritation in the skin. Arsenite is the more toxic of the As (III) and As (V).[10],[11],[12],[13],[14],[15],[16] Both the ionic forms are poisonous to existing organisms; As (III) is more portable, showing it to be more toxic than As (V) due to its neutral form (HAsO2) is the dominant form at neutral pH.[17],[18],[19],[20],[21] Nowadays, arsenic is posturing thoughtful risk to environmental pollution owing to anthropogenic activities such as use of arsenic containing herbicides, pesticides and preservatives of wood, through leather industries and burning of coal.[21] Long-standing exposure to inorganic methods of arsenic has serious impression since these compounds have been recognized as carcinogens to lung and skin in humans.[22],[23],[24],[25],[26],[27],[28] The removal of arsenic from underground wastewater has consequently become vital for safeguarding the drinking water, along with protective aquatic environments. Contamination of water with arsenic remains mostly decontaminated by means of physicochemical methods such as co-precipitation, coagulation, ion exchange, or ultrafiltration, adsorption, and reverse osmosis. Nevertheless, these approaches are expensive and help in the production of secondary pollutants. However, these methods are observed as challenging due to its inability to adequately eliminate As (III) or less concentrated arsenic. These methods need huge number of biochemical reagents, like adsorption and ion exchange. The necessity for cost effective, eco–friendly environment technologies for eliminating arsenic from water has newly become more demanding, now a days excessive attention in the use of bioremediation in order to counter contamination by other metals and arsenic, with numerous studies that is being supported out in this field. There are uncountable studies involving arsenic to many infections from skin rashes, diabetes, lung, and kidney problems, till numerous forms of cancer. Biotic remediation performances, by means of living/dead cell or biosynthesized molecules have been observed.[17],[18],[19] During the growth of algae, fungi, and bacteria, studies have conveyed their ability to transform arsenite to arsenate and vice versa.[24],[29],[30] Mechanisms have been possessed by microorganisms for solubilizing and decreasing the toxicity of several damaging metals. Metal adsorption by microorganisms is typically hypothetical to occur as metals transmit a positive charge, though the microbe surface carries a negative charge. Pre–processing can either be chemical, such as the surfactants use, or physical, such as in heat processing for arsenic to be absorbed by microorganisms, the surface of the microorganisms must be changed. Several microorganisms such as bacteria, fungi, and algae vigorously contribute in arsenic biogeochemical cycle.[31],[32],[33],[34],[35],[36],[37],[38] The arsenic ecology in atmosphere rest on oxidation, methylation, and reduction as three main mechanisms. The arsC family also encompasses the Spx proteins which are Gram negative and Gram-positive transcription factors that control the transcription of multiple genes in response to disulfide stress. Based on the suggestions and reviews given by various authors, the idea of this work is to isolate arsenic degrading microbes present in contaminated soil sample collected from Cauvery River, Pallipalayam and to isolate arsenic degrading gene (Ars C) from the microbial population.
| Methods | | |
Sample collection
Based on the recent studies from the database such as Google Scholar for a period of 2018−2022, the information was retrieved. The key words which we used for our study were (arsenate, arsenic bioremediation, arsenic reducing gene, RAPD, and genetic diversity). The soil sample was collected from Cauvery River, Pallipalayam. The sample was immediately transferred to a laboratory where they were processed.
Growth media for microbial isolation
M9 minimal media
20 ml of 5× M9 salt, 2 ml of carbon source, 0.2 mg of MgSO4, and 0.01 ml CaCl2 composition was prepared as M9 minimal media. The media was made up to 100 ml with sterilized distilled water. 6.4 g of Na2HPO4, 1.5g of KH2PO4, 0.25g of NaCl, 0.5g of NH4Cl is the composition of 5x M9 salts. The above concentration of chemicals was taken and was made up to 100 ml in standard flask after which it was sterilized and kept as stock solution. Carbon source taken for the growth of arsenic degrading organism was 0.4% sodium arsenate. One gram of the collected sample was added to the M9 Minimal media and was incubated in the shaker at 37°C for 3 days.
Nutrient agar media
3.0 g of Agar, 0.3 g of yeast extract, 0.3 g of beef extract, 0.5 g of peptone, 0.5 g of sodium chloride was taken, and the nutrient agar media was made up to 100 ml.
Luria bertani broth
1.0 g of tryptone/peptone, 0.5 g of NaCl, and 0.5 g of yeast extract were maintained with pH 7.2 and was made up to 100 ml. The above mixture is Luria bertani broth.
Tryptone broth composition
One gram of tryptote was allowed to dissolve in 100 ml distilled water.
Biochemical test
Gram's staining
In a microscopic slide, a drop of water was added and the culture was smeared and heat fixed. Then crystal violet was added and stained for 60 s followed by washing with running water. Similarly, Gram's iodine, ethanol and saffronin were added and stained for 60 s, 30 s, and 2 min. The slide was air dried and viewed under microscope for the determination of pink color.
Indole test
The culture was inoculated into tryptone broth and kept in incubation for 24 to 48 h at 37°C in. After incubation, Kovac's reagent was added. The formation of deep cherry red color indicates the production of organic acids. Thus, the result shows positive.
Methyl red test
The culture was allowed to be inoculated to glucose phosphate peptone broth and kept at incubation time of 24−48 h at 37°C. Afterward, 5 droplets of methyl red indicator was added to the tubes. The formation of a red color indicates positive result to methyl red test.
Broth composition
0.7g of peptone, 0.5g glucose, and 0.5 g of potassium phosphate were dissolved in 100 ml distilled water.
Voges-proskauer test
The culture was inoculated in the test tubes and incubated for 48 h at 37°C. After incubation, Voges-Proskauer reagent was added and gently mixed and allowed to stand for 15 min. The color change from yellow to pink indicates positive result.
Citrate utilization test
Slant of Simmon's citrate agar medium was prepared and the culture was inoculated. The tubes are kept for 48 h at 37°C. The color change from blue to green indicates the utilization of citrate by the culture and the result is positive.
Simmon's citrate agar
0.2 g of sodium citrate, 0.02 g of magnesium sulfate, 0.1 g of ammonium di-hydrogen phosphate, 0.1 g of potassium hydrogen phosphate, 0.08 g of bromothymol blue, and 3 g of Agar were dissolved in 100 ml distilled water.
Catalase test
The culture was inoculated into nutrient broth and kept for incubation at 37°C for 24 h. To the overnight culture, 3% hydrogen peroxide was added. Occurrence of oxygen evolution indicates positive result.
Oxidase test
The filter paper soaked with the substrate tetramethyl-p- phenylenediamine dihydrochloride and moisten the paper with sterile distilled water. Colony was streaked on the paper using platinum loop. Color change to deep blue or purple color indicates positive result.
Carbohydrate fermentation test
Glucose broth was taken in test tube and Durham's tubes were introduced without any air bubbles and sterilization was carried out. After sterilization, bacterial colonies were inoculated into broth and incubated for 24–48 h. After incubation, color change with gas formation indicates the occurrence of glucose fermentation.
Endospore staining
The primary stain used was malachite green that stains together endospores and vegetative cells. Heat temperature was applied to help the primary stain enter the endospore. The cells are then dissolved in water for decolorization to eliminate the malachite green from the vegetative cell but not the endospore. Safranin was allowed to stain counter which is decolorized. Finally, pink color seems to be vegetative cells and dark green will be endospores.
Mannitol test
A pure culture inoculum is transmitted aseptically into sterile tube of phenol red mannitol broth. The inoculated tube is kept in incubation at 3-37 °C for 24 hrs and the determined results in recorded. A color change from red to yellow indicates positive test and indicates an acidic pH change.
Standardized DNA isolation protocol
Based on methods suggested by researchers-ERIC PAGET, YU-LI TSAI, MARY ANN BRUNS, JAMES McD. STEWART, etc., following protocol was standardized. Two ml of overnight incubated culture was centrifuged at 6000 rpm for 10 min. The above step was repeated twice. To the pellet, 500 μl of sucrose TE was added and pellet was suspended in it. Thirty-two microliters of lysozyme (100 mg/ml) was added and vortex well for 30 s. The tube was incubated at 37°c for 30 min and it was gently mixed for every 10 min during incubation. 100μl of EDTA (0.5M) was added to the above mixture followed by addition of 60μl of SDS (10%) and vortex for 30 s. Then 5 μl of proteinase K was added and mixed for 30 s. The sample mixture was incubated at 55°C for 16 h. Seven hundred and microliters of Phenol: chloroform mixture (1:1) was added and vortex for 30 s. It was centrifuged at 12000 rpm for 10 min. Aqueous phase was collected and to the above mixture equal volume of Phenol: Chloroform: isoamylalcohol (25:24:1). It was vortexed for 30 s till the appearance of milky white solution. The solution was centrifuged at 12000 rpm for 10 min. To the aqueous phase, 2.5 volume of absolute alcohol was added and vortex well for 15 s. The mixture was centrifuged at 12000 rpm for 10 min. The supernatant was discarded and to the pellet, 100 μl of 70% alcohol was added and centrifuged at 12,000 rpm for 5 min. The pellet was dried at 70°C for 2 min. Pellet was suspended in 20μl of sterile water and stored at −20°C.
Agarose gel electrophoresis
Gel electrophoresis was executed using 0.8% agarose dissolved in 1X TAE buffer. DNA obtained by various protocols was loaded on to the casted agarose along with the 6X gel loading dye which was electrophoresed at 100 V for 30 min.
Gel extraction protocol
Extracted DNA was purified using gel extraction kit. The sliced gel piece containing sample was dissolved in 2.5 volume of sodium iodide solution and boiled at 60°C followed by addition of 20 μl of silica and then bound DNA was eluted by adding wash buffer and heating at 65°C for 5 min, the eluted DNA dissolved in 40 μl of Sterile Distilled Water.
Primer designing protocol
Arsenate reductase (ArcC) gene-specific primer set was designed using Primer3 tool (Online primer designing tool). For designing primers, melting temperature of the primers was taken as minimum of 55°C to maximum of 65°C, GC content was taken as minimum of 40% to maximum of 60% and the length of the primer was taken as minimum of 18 to maximum of 30 nucleotides.
Polymerase chain reaction based on RAPD analysis
Amplification reactions were carried out in 25 μl of total volume containing 2 μl of template DNA, 1.5 μl of 10 mM DNTP mix, 2.5μl 10× Taq buffer, 1μl of Taq DNA Polymerase, 1 μl of RBA-1 Primer and 17 μl of sterile distilled water. The amplification process was accomplished in thermal cycler. The polymerase chain reaction cycle was as follows: Initial denaturation was set as 94°C for 5 min and the following steps were maintained for 10 cycles. Denaturation at 94°C for 45 s followed by 36°C annealing for 1 min and 72°C extension for 1.5 min. Following that, three steps that were maintained for 30 cycles are as follows: Denaturation at 94°C at 40 s followed by annealing at 38°C for 1 min and the extension at 72°C for 1 min. The extension period was maintained for 10 min at 72°C. Aliquots of the amplified products were analyzed by electrophoresis in 1.5% agarose gel in 1X TAE buffer (40mM Tris. 20 mM acetic acid, 1mM pH 8 EDTA), stained with ethidium bromide and electrophoresis was carried out at 50 volts for 3 h using TAE buffer. The molecular marker was 1Kb and 100bp ladder. The gel was observed on a UV Transilluminator and photographed.
RAPD band profiles
RAPD band profiles were recorded by manually comparing the RAPD amplification profiles and scoring the absence and presence of individual band in respective profile. The agarose gel electrophoresis formation was obtained was digitized to a two character – discrete-matrix (0 for absence and 1 for presence of RAPD band patterns), thus the binary matrix was constructed. The hierarchal groups were created based on Unweighted Pair Group using Arithmetic Averages (UPGMA). Similarity, matrix and distance matrix were constructed with respect to Jaccard coefficient using binary matrix in UPGMA. Thereby, dendrogram was generated for the isolates.
| Results | | |
Isolation of microbial population serial dilution
To isolate arsenic degrading microbes, the collected soil sample was serially diluted. With the dilution concentrations, 10−5 and 10−6 microbial population was obtained in M9 minimal media (supplemented with 0.4% sodium arsenate as substrate) after 4 days of incubation.
Isolation of pure cultures
Among the microbial population obtained, four isolates were chosen for further studies. Pure colonies of the isolates were obtained by cultivating them in M9 minimal media [Figure 1], [Figure 2], [Figure 3].
Biochemical characteristics
Biochemical and morphological characteristics of the isolates were determined by biochemical tests and Gram's staining according to Bergey's Manual of Systematic Bacteriology.[19] The study results designated the following [Table 1]. | Table 1: Morphological and Biochemical characteristics of microbial isolates
Click here to view |
Genomic DNA
From the pure colonies of isolates, TA1, TA2, TA4, and TA5 genomic DNA was extracted using the protocol mentioned above. The culture was inoculated in LB broth and kept in incubation at 37°C for overnight. From overnight culture, genomic DNA was extracted [Figure 4] and [Figure 5]. | Figure 5: Purified genomic DNA. Lane 1: Purified genomic DNA of TA2. Lane 2: Purified Genomic DNA of TA4. Lane 3: Purified genomic DNA of TA5
Click here to view |
Purified DNA
Gel Extraction Kit was used to purify extracted genomic DNA.
Primer sequence
Using Primer 3 tool, ArcC gene primer set was designed based on the conserved domains of cystein residues in thioredoxin superfamily. Designed primer set contains the following features [Table 2].
RAPD results
RAPD analysis for the isolates was performed using four different random primers namely RBA-1, RBA-4, RBA-5, and RBA-6. Results of RAPD studies for different primers were shown below [Figure 6], [Figure 7], [Figure 8], [Figure 9].
Binary matrix
Binary matrix of RAPD products for RBA- 1, RBA - 4, RBA - 5, RBA - 6 are provided in the [Table 3],[Table 4],[Table 5],[Table 6]. | Table 3: Binary matrix of random amplified polymorphic DNA products for RBA-1
Click here to view |
 | Table 4: Binary matrix of andom amplified polymorphic DNA products for RBA-4
Click here to view |
 | Table 5: Binary matrix of andom amplified polymorphic DNA products for RBA-5
Click here to view |
 | Table 6: Binary matrix of andom amplified polymorphic DNA products for RBA-6
Click here to view |
Similarity and distance matrix
Similarity and distance matrix for RBA - 1, RBA - 4, RBA - 5, RBA - 6 are mentioned in the [Table 7],[Table 8],[Table 9],[Table 10],[Table 11],[Table 12],[Table 13],[Table 14].
| Discussion | | |
With the development of various genetic engineering techniques, a similar study was performed by Malik et al., (2021)[23] in which ArcC gene encoding thioredoxin superfamily from haloalkaliphile, Gram-positive, Bacillus selenitireducens strain MLS10 was isolated, purified, and characterizations was done. Insight to this experiment, ArcC gene was isolated using sodium arsenate as substrate. However, the strain had only 10Mm of sodium arsenate degrading property. In the current investigation, an effort was made to isolate potent arsenic degrading microbes from contaminated soil to screen them for ArcC gene.
Further, isolation of microbial population with potent arsenic degrading property was performed. They were isolated with 40 mM of sodium arsenate degrading property. The presence of ArcC gene activity was confirmed by the zone of clearance. Depending on the biochemical and morphological characteristics, TA2, TA4, and TA5 isolates belonged to Staphylococcus, Bacillus, and Pseudomonas. DNA isolation protocol was standardized in our present study. To amplify ArcC gene from the DNA samples of all the isolates, ArcC gene specific primer set F: 5'GGCACGCCATTCTTTTTAAC3' and R: 5'TGAAGTGGACAAACCATCCA3' were designed using Primer3 (bioinformatics tool).
RAPD analysis was performed for the isolates using different primers namely RBA-1, RBA4, RBA-5, RBA-6. The RAPD technique was used to elucidate the polymorphism among the isolates and to ascertain their possible relationship with arsenic degrading activity. Dendrogram (phylogenetic tree) was constructed by Dendro-UPGMA cluster analysis.
| Conclusion | | |
In this present study, microbial population with arsenic degrading property have been isolated using sodium arsenate as a sole carbon source amended M9 minimal media. Among them, three of the isolates designated as TA2, TA4, and TA5 were found to be potent arsenic degarding microbes. They are able to degrade sodium arsenate of about 40mM. Based on methods suggested by researchers, ERIC PAGET, YU-LI TSAI, MARY ANN BRUNS, JAMES McD. STEWART, etc., DNA isolation protocol was standardized. DNA isolation for all the isolates was performed. DNA purification was done using the gel extraction kit.
The ArcC gene-specific primer set was designed by Primer3 tool. RAPD analysis was performed for isolates using four different primers to study the polymorphism. For comparative analysis, phylogenetic tree was constructed by Dendro-UPGMA tool. Relationship among the isolates were analyzed from the phylogenetic tree. It infers that they can be potentially used in bioremediation of arsenic. Isolation of ArcC gene from the isolates is in progress. Sequencing will reveal the nature of amplified products. If the amplified genes are cloned and mass production of ArcC gene could be obtained.
Financial support and sponsorship
Nil.
Conflicts of interest
There are no conflicts of interest.
| References | | |
| 1. | Haung A, Teplitski T, Rathinasabapathi B, Ma L. Characterization of arsenic-resistant bacteria from rizosphere of arsenic hyperaccumulator Pteris vittata. Can J Microbiol 2010;56:236-46.  |
| 2. | Bahig AE, Aly EA, Khaled AA, Amel KA. Isolation, characterization and application of bacterial population from agricultural soil at Sohag Province. Malays J Microbiol 2008;4:42-50. |
| 3. | Bala S, Garg D, Thirumalesh BV, Sharma M, Sridhar K, Inbaraj BS, et al. Recent strategies for bioremediation of emerging pollutants: A review for a green and sustainable environment. Toxics 2022;10:484. |
| 4. | Bhattacharya P, Samal AC, Majumdar J. Arsenic contamination in Rice, Wheat, Pulses and Vegetables: A study in an arsenic Affected area of West Bengal, India. Springer 2010;213:3-13. |
| 5. | Jackson CR, Harrison KG, Dugas SL. Enumeration and characterization of culturable arsenate resistant bacteria in a large estuary. Elsevier, 2205;28:727-34. |
| 6. | Chakraborty P. Contrasting role of autophagy in different types of cancer: A review toward biomarkers and therapeutic improvement. Biomed Biotechnol Res J (BBRJ) 2021;5:260. |
| 7. | Richey C, Chovanec P, Hoeft SE, Oremland RS, Basu P, Stolz JF. Respiratory arsenate reductase as a bidirectional enzyme. Vol. 382. Elsevier; 2009. p. 298-302. |
| 8. | Afkar E, Lisak J, Saltikov C, Basu P, Oremland RS, Stolz JF. The respiratory arsenate reductase from Bacillus selenitireducens strain MLS10. FEMS Microbiol Lett 2003;226:107-12. |
| 9. | Evens AM, Tallman MS, Gartenhaus RB. The potential of arsenic trioxide in the treatment of malignant disease: Past, present, and future. Leuk Res 2004;28:891-900. |
| 10. | Bhosale GP, Bachate SP, Kale SC. Isolation and characterization of arsenate reducing bacteria from the waste water of an electroplating industry. Int J Curr Microbiol Appl Sci 2014;3:444-52. |
| 11. | Hasegawa H, Sohrin Y, Seki K, Sato M, Norisuye K, Naito K, et al. Biosynthesis and release of methylarsenic compounds during the growth of freshwater algae. Chemosphere 2001;43:265-72. |
| 12. | Messens J, Martins JC, Van Belle K, Brosens E, Desmyter A, De Gieter M, et al. All intermediates of the arsenate reductase mechanism, including an intramolecular dynamic disulfide cascade. Proc Natl Acad Sci U S A 2002;99:8506-11. |
| 13. | Joseph J, Deborah KS, Raghavi R, Shamya AM, Aruni W. Green synthesis of silver nanoparticles using Phyllanthus amarus seeds and their antibacterial activity assessment. Biomed Biotechnol Res J (BBRJ) 2021;5:35. |
| 14. | Krumova K, Nikolovska M, Groudeva V. Isolation and identification of arsenic-transforming bacteria from arsenic contaminated sites in Bulgaria. Biotechnol Biotechnol Equip 2008;2:721-8. |
| 15. | Kadhim FH, Mohammed SH. Microbiological profile, antibiogram, and risk factors of patients with diabetic foot infections: A systemic metaanalysis. Biomed Biotechnol Res J (BBRJ) 2021;5:235. |
| 16. | Kaise T, Kinoshita K. Chemical treatment and decomposition technique of the chemical warfare agents containing arsenicals. Yakugaku Zasshi 2009;129:45-51. |
| 17. | Lizama K, Fletcher TD, Sun G. Removal processes for arsenic in constructed wetlands. Chemosphere, 2011;84:1032-43. |
| 18. | Katsoyiannis I, Zouboulis A, Althoff H, Bartel H. As (III) removal from groundwaters using fixed-bed upflow bioreactors. Chemosphere 2002;47:325-32. |
| 19. | Kour D, Kaur T, Devi R, Yadav A, Singh M, Joshi D, et al. Beneficial microbiomes for bioremediation of diverse contaminated environments for environmental sustainability: Present status and future challenges. Environ Sci Pollut Res Int 2021;28:24917-39. |
| 20. | Nakamiya K, Nakayama T, Ito H, Edmonds JS, Shibata Y, Morita M. Degradation of arylarsenic compounds by microorganisms. FEMS Microbiol Lett 2007;274:184-8. |
| 21. | Wang L, Jeon B, Sahin O, Zhang Q. Identification of an arsenic resistance and arsenic-sensing system in Campylobacter jejuni. Appl Environ Microbiol 2009;75:5064-73. |
| 22. | Lu J, Chew EH, Holmgren A. Targeting thioredoxin reductase is a basis for cancer therapy by arsenic trioxide. Proc Natl Acad Sci U S A 2007;104:12288-93. |
| 23. | Malik S, Rana JS, Nehra K. Prevalence and antibiotic susceptibility pattern of uropathogenic Escherichia coli strains in sonipat region of Haryana in India. Biomed Biotechnol Res J (BBRJ) 2021;5:80. |
| 24. | Mujwar S. Computational bioprospecting of andrographolide derivatives as potent cyclooxygenase-2 inhibitors. Biomed Biotechnol Res J (BBRJ) 2021;5:446. |
| 25. | Munetoshi M, Hayarshi S. Characterization of arsenic removal from solution by Bacillus magaterium strain UM-123. J Environ Biotechnol 2009;9:123-9. |
| 26. | Surve NN. Arsenic toxicity in pathogenic staphylococcus epidermidis. Niggemyer S. Spring E. Stackebrandt, Rosenzweig RF. (2001). Appl Environ Microbiol 2010;67:5568-80. |
| 27. | D Chandrakumar, K Manigundan, K Gopalakrishnan, V Karuppiah, N Rajendra Prasad, M Radhakrishnan, et al. Novel strain of Nocardiopsis sp. CN2 from andaman nicobar islands: Isolation, taxonomy, fermentation, and antiproliferative effect on cervical cancer cells.Biomedical and Biotechnology Research Journal (BBRJ) 2020;4:200-8. |
| 28. | Shakya S, Pradhan B. Isolation and characterization of arsenic resistant Pseudomonas stutzeri asp3 for its potential in arsenic resistance and removal. Kathmandu Univ J Sci 2013;9:48-59. |
| 29. | Banerjee S, Majumdar J, Samal AK, Bhattachariya P, Santra SC. Biotransformation and bioaccumulation of arsenic by Brevibacillus brevis isolated from arsenic contaminated region of West Bengal. IOSR J Environ Sci Toxicol Food Technol 2013;3:01-10. |
| 30. | Selvakumar P. Phytochemical and pharmacological profile review of Bryophyllum pinnatum. Biomed Biotechnol Res J (BBRJ) 2022;6:295. |
| 31. | Shipley S, Nordin AB, Tang CG, Kim SK. Phytoremediation for arsenic contamination: Arsenate reductase. Pulse 2008;6:1-12. |
| 32. | Wang SW. Role of in-situ reducing bacteria on arsenic mobility in aquitard groundwater. IPCBEE 2011;8:286-90. |
| 33. | Smedley PL, Kinniburgh DG. A review of the source, behaviour and distribution of arsenic in natural waters. Appl Geochem 2002;17:517-68. |
| 34. | Visoottiviseth P, Francesconi K, Sridokchan W. The potential of Thai indigenous plant species for the phytoremediation of arsenic contaminated land. Environ Pollut 2002;118:453-61. |
| 35. | Wilopo W, Sasaki K, Hirajima T. Identification of sulfate- and arsenate-reducing bacteria in sheep manure as permeable reactive materials after arsenic immobilization in groundwater. Mater Trans 2008;49:2275-82. |
| 36. | Wang R, Wu B, Zheng J, Chen H, Rao P, Yan L, et al. Biodegradation of total petroleum hydrocarbons in soil: Isolation and characterization of bacterial strains from oil contaminated soil. Appl Sci 2020;10:4173. |
| 37. | Wang ZY, Chen Z. Acute promyelocytic leukemia: From highly fatal to highly curable. Blood 2008;111:2505-15. |
| 38. | Guo X, Li Y, Peng K, Hu Y, Li C, Xia B, et al. Solution structures and backbone dynamics of arsenate reductase from Bacillus subtilis: Reversible conformational switch associated with arsenate reduction. J Biol Chem 2005;280:39601-8. |
[Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6], [Figure 7], [Figure 8], [Figure 9]
[Table 1], [Table 2], [Table 3], [Table 4], [Table 5], [Table 6], [Table 7], [Table 8], [Table 9], [Table 10], [Table 11], [Table 12], [Table 13], [Table 14]
|
Search Pubmed for