• Users Online: 368
  • Print this page
  • Email this page


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2022  |  Volume : 6  |  Issue : 2  |  Page : 224-229

Comparing pili producing gene (mtp-flp) in susceptible and resistant dormant Mycobacterium tuberculosis strains with active clinical isolates


1 Department of Microbiology, North Tehran Branch, Islamic Azad University, Tehran, Iran
2 Mycobacteriology Research Center, National Research Institute of Tuberculosis and Lung Disease, Shahid Beheshti University of Medical Sciences, Tehran, Iran
3 Mycobacteriology Research Center, National Research Institute of Tuberculosis and Lung Disease, Shahid Beheshti University of Medical Sciences; Department of Biotechnology, School of Advanced Technology in Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran

Date of Submission30-Dec-2021
Date of Acceptance28-Apr-2022
Date of Web Publication17-Jun-2022

Correspondence Address:
Parissa Farnia
Mycobacteriology Research Center, National Research Institute of Tuberculosis and Lung Disease, Shahid Beheshti University of Medical Sciences, Tehran
Iran
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/bbrj.bbrj_326_21

Rights and Permissions
  Abstract 


Background: Pili producing genes in different life cycles of Mycobacterium tuberculosis (M. tuberculosis) were assessed. M. tuberculosis has two life cycles: dormant and active states. We aimed to assess the pili producing genes such as curli pili of M. tuberculosis (mtp) encoded by the mtp gene (Rv3312A) and fimbrial low-molecular-weight protein encoded by flp gene (Rv3656c) which were compared and analyzed. Methods: Two hundred M. tuberculosis isolates were investigated both at active and dormant states for production and expression of pili. The dormant M. tuberculosis was achieved by incubation in a sealed tube (modified Wayne method). The susceptibility of M. tuberculosis was evaluated on genes, rpob, inh, katg, and gyra by using multiplex polymerase chain reaction (PCR) and single-strand conformational polymorphism methods. The PCR–restriction fragment length polymorphism was used to express pili genes mtp and flp and then the PCR products was digested using restriction enzyme Fnu4HI, XmaI, and MspJI and AciI, TagII, and HaeII, respectively. The transmission electron microscopy was also used to detect pili in different isolates. The result was compared and analyzed using H37RV as a gold standard. Results: The mtp and flp PCR products were 263 and 122 bp in the studied strains irrespective of M. tuberculosis different life cycles, respectively. The PCR products were analyzed on 8% Polyacrylamide gel electrophoresis (PAGE), and in the 180/200 (20%), producing five fragments of 25,40,45,63,90 bp with the Fun4HI and two fragments of 126,138 bp with the XmaI and uncut with the MspJI for mtp gen were obtained at the dormant and active states of M. tuberculosis (P < 0.05). Similarly in flp gene producing three fragments of 22,35,65 bp with AciI and two fragments of 35.87 bp with TagII and two fragments of 38.84 bp with HaeII were obtained (P < 0.05). In contrast to genotyping analysis, the electron microscopy examination showed protruding of pili from M. tuberculosis, especially in dormant mycobacterium (15/100; 15%), that was multidrug resistance and extensive drug resistance isolates (P > 0.05). Conclusion: Pili were shown by electron microscopy, although at the gene expression, the insignificant difference was observed at the dormant strains in comparison to active states. Therefore, we may conclude that other genes might be involved in pili production of M. tuberculosis that needs further investigation. Although, the resistance phenomena might influence the pili producing gene expression that showed in our results.

Keywords: Dormancy, drug-resistance, Mycobacterium tuberculosis, pili


How to cite this article:
Nasirzadeh Z, Farnia P, Nowroozi J, Farnia P, Velayati AA. Comparing pili producing gene (mtp-flp) in susceptible and resistant dormant Mycobacterium tuberculosis strains with active clinical isolates. Biomed Biotechnol Res J 2022;6:224-9

How to cite this URL:
Nasirzadeh Z, Farnia P, Nowroozi J, Farnia P, Velayati AA. Comparing pili producing gene (mtp-flp) in susceptible and resistant dormant Mycobacterium tuberculosis strains with active clinical isolates. Biomed Biotechnol Res J [serial online] 2022 [cited 2022 Dec 9];6:224-9. Available from: https://www.bmbtrj.org/text.asp?2022/6/2/224/347718




  Introduction Top


Mycobacterium tuberculosis (M. tuberculosis), which is responsible for a huge number of human mortality and morbidity throughout the world, is still to be considered to be among the most important infectious diseases.[1],[2] Despite the remarkable development of molecular methods and relative promotion, there are many questions which need to be answered in M. tuberculosis, e.g., pili production, dormant or active state. Pili or fimbriae that were reported for the first time in 1950[1],[3] are a hair-like appendage found on the surface of many bacteria and 13 archaea.[4] The pili discovery in Gram-negative and Gram-positive bacteria back to late 1968, but the first report of pili production M. tuberculosis was in 2005.[5],[6] The adherence appendages called pili (fimbriae) could be mediating directly or indirectly in the interaction between pathogen and specific host target cells.[7],[8] Pili are viewed as virulence factors that have key roles in bacterial pathogenesis.[7],[8] Pili or fimbriae are straight or flexible filamentous structures that required several genes for their biogenesis.[3],[9],[10] Bacterial adherence, biofilm formation, DNA uptake during transformation, cell-cell interaction and colonization of mucosal surfaces, and agglutination of human or animal erythrocytes are of biological activities that are associated with pili.[9],[11],[12],[13] Like other microorganisms, it has been reported that M. tuberculosis is also capable of producing more than one type of pili.[3],[7] M. tuberculosis pili (MTP) protein has a molecular weight of 361 bp and Flp protein has a molecular weight of 150 bp, which are considered to be important gene targets (mtp and flp) for expression of pili producing genes.[9],[11],[14],[15] The genes Mtp and Flp in H37RV are shown to have 4–6 kb protein subunits predicted by open reading frame.[9],[11],[14],[16]

The hotspot mutation points in these genes were identified to be 4095498 for flp (G → A), and 3701119 for mtp (G → A) genes, which recognize as nonsense mutants for pili production.

Therefore, it might be possible to consider pili as an important appendage for immune system cell attachment that brings initiation and progression of TB in the host cells.[2],[8],[17] That is a reason, more effort is needed to better understand the molecular biology of pili in M. tuberculosis. Recently, Velayati et al. had shown a difference in release of pili at M. tuberculosis in dormant and active states.[3],[18],[19],[20]

Here, we aimed to investigate pili express producing genes (mtp and flp) in different life cycles of isolates. Moreover, isolates were subdivided by their susceptibility results. The studied isolates were compared and analyzed using result of H37RV with active and dormant states of clinical isolates.


  Materials and Methods Top


Clinical sample

The AFB-positive culture samples were collected randomly based on their susceptibility and identification results (n: 200), That referred to Mycobacteriology Research Center, and Lung Diseases National Research Institute of Tuberculosis and Lung Diseases (NRITLD) in 2017–2019. The Ethical Committee of Scientific Board of the NRITLD, Shahid Beheshti University of Medical Sciences, Tehran, Iran, was approved the study (IR.SBMU.REC.1397.565). Furthermore, all patients submitted their written consent before the study.

Identification of bacterial strain

DNA extraction from AFB positive culture was carried out using Qiagen kits (Qiagen, Hilden, Germany) according to the manufacturer's instruction. To identify the M. tuberculosis complex, the single polymerase chain reaction (PCR) using primers: F 5΄ATCCTGCGA GCGTAGGCGTCGG 3΄ and R 5΄CAGGACCACGATCGCTGATCCGG 3΄ was used to identify IS6110 [Table 1].[21],[22] The PCR products were observed on 1.5% agarose gel electrophoresis. All the strains used in this study were previously identified by classical methods using nitrate, niacin, and catalase tests.[22],[23] The first- and second-line antituberculosis drug susceptibility testing was performed.[24],[25] These genes used for molecular susceptibility testing for first-line drugs were rpob, inha, and katg using multiplex-PCR [Table 1].[26] In this study we used multiplex pcr based assay to simultaneously detect resistance against the first and second line antibiotics. Multiplex pcr reactions were carried out to detect mutations in rpoB gene (for resistance againset riampin), katG, inhA genes (for resistance against isoniazid), emb genes (for resistance against etambutol). For second line we used PCR-RFLP method for rrs (amikacin and kanamycine) then digested by (taiI and DdeI) and touch down pcr gyrA for (ciprofloxacine). Here, also proportional methods for first- and second-line drugs “based on the WHO protocols” were performed on all studied cases.[27] To avoid any confusion, only the cases which had similar proportional and molecular results were selected for further studies [Table 1].
Table 1: List of primers used for drugs susceptibility testing by multiplex-polymerase chain reaction, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-single-strand conformation polymorphism

Click here to view


Dormant state of Mycobacterium tuberculosis

The method used for dormancy was a modification of the Wayne method used for dormancy.[28] Growth conditions for induction of in vitro dormancy model were as follows: briefly susceptible, multidrug resistance (MDR), and XDR-TB strain was cultured at 37°C in middle brook 7H9 liquid medium, which was supplemented with 10% albumin, catalase, dextrose, and oleic acid as well as 0.5% glycerol and 0.05% Tween 80, at a final PH 6.6 ± 0.2.[28],[29],[30] A total of 5 ml of prepared medium with TB isolates was transferred into screw cap test tubes containing magnetic stirrers in a 37°C incubator.[28],[29],[30] Culture tubes were closed by tightly screwing down-solid caps and then stirred gently (based on magnetic stirring platforms at 100–120 rpm, 37°C) for 96 h.[28],[29],[30] Under this condition, gradually, oxygen and nitrogen were reduced, and bacilli were in their dormant state.[28],[29],[30] Monitoring of oxygen depletion was performed via decolorization of methylene blue as a redox indicator in control tubes. The reduction and decolorization of methylene blue dye served as a visual indication of oxygen consumption and hypoxia. Overall, three parallel sets of sealed cultures were included for each isolate.[28],[29],[30]

Active state of Mycobacterium tuberculosis

A few loops of the AFB culture-positive bacilli were taken and incubated in 7H9 medium. The bacilli were kept at 37°C which were supplemented with 10% albumin, catalase, dextrose, and oleic acid as well as 0.5% glycerol and 0.05% Tween 80, at a final PH 6.6 ± 0.2, using magnetic stirring platforms at 100–120 rpm. After 24 h, the culture was used for further experiments.[31],[32]

Examination of mtp and flp gene mutation in active and dormant bacilli

Mutation in 3701119 for mtp and in 4095498 for flp gene was studied in all isolates and compared with H37RV. To identify the pili genes, the single PCR using primers for mtp gene: F: 5' ATGTACCGGTTCGCGTGC 3' and R: 5' TCAAGCACGGGACCTTCG 3, also for flp gene were used this primer, F: 5' AATACGCCATCGGTACCATCG 3' and R: 5' AACCTTGGTGCTGAGCGC 3' [Table 2]. For both of the genes, the same PCR programs were used; denaturation, at 95°C for 5 min, annealing at 53°C for 30 s, with a final extension step at 72°C for 10 min. Then, the PCR products were electrophoresed and visualized using 1.5% agarose gel [Figure 1].
Table 2: List of specific primers and restriction enzymes for a mutant form of Mycobacterium tuberculosis curli pili and flp genes

Click here to view
Figure 1: (a) Polymerase chain reaction results of mtp (263 bp) for a number of isolates, (b) polymerase chain reaction results of flp (122 bp) for a number of isolates

Click here to view


For mtp gene the PCR product (263 bp) and then three restriction enzymes (Fnu4HI, XmaI, MspJI) were used; producing five fragments of 25,40,45,63,90 bp with the Fun4HI and two fragments of 126,138 bp with the XmaI and uncut with the MspJI for mtp gen were obtained at the dormant and active states of M. tuberculosis (P < 0.05). Similarly in flp gene producing three fragments of 22,35,65 bp with AciI and two fragments of 35.87 bp with TagII and two fragments of 38.84 bp with HaeII were obtained (P < 0.05) [Table 2]. The PCR-RFLP products were observed using 8% polyacrylamide gel electrophoresis [Figure 2]e, [Figure 2]f, [Figure 2]g.
Figure 2: Restriction fragment length polymorphism analysis of Mycobacterium tuberculosis, Genomic DNAs from M Mycobacterium tuberculosis, active and dormant isolates (lanes 1, 3, 5, and 7). (a) Were digested with Fnu4HI and (b) were digested with XmaI and (c) Were digested with MspjI. (d) Were digested with AciI. (e) Were digested with TaqII and (f) were digested with HaeII. Number (1-2-3, susceptible, multidrug resistance and XDR) isolate respectively in active state, number (4-5-6, susceptible, multidrug resistance and XDR) isolate respectively in dormant state, and number (7: H37RV).

Click here to view


Transmission electron microscopy

To study the pili structure morphologically using transmission electron microscopy (TEM), the specimens were cultured in Mueller-Hinton broth as a first step. Then, the specimens were observed by electron microscopy using negative staining. Dehydration was done using 25%, 50%, 70%, 90%, and 100% ethanol concentrations for three times and each time for 10–15 min.[5],[33] Then, the specimen was put in propylene oxide for two times (each time 30 min). Then, it was placed in the resin and propylene oxide with the portions of 1:2, 1:1, and 2:1 for 2–3 h.[5],[33] Then, it was put into pure resin and molded. Later, it was placed into an oven at 60°C for 2–3 days. Cutting performed by ultramicrotome machine (Umo3 model of Richert Company, Austria). The slices were placed on a 300-mesh copper grid and investigated under TEM [Figure 3].[5],[33]
Figure 3: Pili structure of Mycobacterium tuberculosis with using transmission electron microscopy

Click here to view


Statistical analysis

SPSS v. 22 (SPSS Inc., Chicago, IL, USA) was applied for statistical analyses. The Fisher's exact test and Chi-square were performed for studied parameters, and P < 0.05 was considered statistically significant.


  Results Top


Identification and susceptibility test

A total of 200 AFB culture-positive specimens that were collected from pulmonary tuberculosis cases were included in this present study. They belonged to 128 (64%) male and 72 (36%) female patients with a mean age of 47 ± 11.7. One hundred strains were kept in potential division and 100 strains were brought to inactivated state in TB laboratory. Overall, the samples were 72% sensitive, 20% MDR, and 8% XDR by both proportional and molecular tests. For control, H37RV was used as a reference strain.

Expression of mutant mtp and flp genes

PCR method was performed to determine mtp and flp genes' presence of in active and dormant M. tuberculosis strains [Figure 1].

Dormant bacilli

In all isolates, the amplified product of the mtp gene produces 263 bp (100/100; 100%). The results of the restriction enzyme were almost similar in the majority of isolates (10/100; 90%). By Fnu4HI, restriction enzyme, the obtain was five fragments of 25-40-45-63-90 bp in 90 strains (90%) [Figure 2]a, while in 10%, they showed different patterns of 30-43-80-110 bp in srtais [Figure 4]a. These patterns were observed in MDR or XDR dormant M. tuberculosis states. Similarly, with XmaI, 90% of isolates produced 126–138 bp fragments [Figure 2]b, whereas in DRs, they produce fragments of 120–143 bp fragment [Figure 4]b. When the using MspJI, amplified products remained uncut irrespective of their state of and susceptibility test [Figure 2]c.
Figure 4: Different patterns in multidrug resistance and XDR of Mycobacterium tuberculosis in dormant isolates. (a) Different patterns whit digested by Fnu4HI, (b) different patterns whit digested by XmaI for mtp gene. (c) Different patterns whit digested by AciI, (d) different patterns whit digested by TaqII and (e), different patterns whit digested by HaeII for flp gene. Number (1,2,3) H37RV, multidrug resistance and XDR isolates respectively

Click here to view


For flp gene, the amplified PCR product was 122 bp (100/100; 100%) [Figure 1]b. Although, when digested using AciI, TaqII, and HaeII, the differences were observed in dormant MDR and XDR strains, as shown in [Figure 4]c, [Figure 4]d, [Figure 4]e.

Active bacilli

The obtained pattern with the mtp and flp was similar to dormant state just in total, 5/100 of DR isolates showed different patterns. We showed that the number of differences was lower in active cases than dormant isolates (10/100). These isolates belonged to drug-resistant strains (DRs) of pulmonary tuberculosis cases which were considered as treatment failure cases (10/100).


  Discussion Top


A recent development in molecular technology and/or modern microscopy has increased our knowledge about M. tuberculosis pathophysiology. However, there remained many unresolved questions that remained to be answered. Among the important objective is the presence or absence of pili structure. With using EMS, we already have shown the presence of pili in TB, either laboratory strains (H37RV) or wild types of isolates in their active and dormant states [Figure 3].

In 2007, for the first time, Alteri et al. reported that M. tuberculosis could produce pili in laboratory standard strains (H37RV).[9] Based on their findings using TEM and SEM electron microscopy, the presence of pili-like structures within the bacteria was confirmed by other investigators and it was stated that this human pathogen was also capable of producing different types of pili according to the different conditions.[9],[33],[34] In 2011, Velayati et al. by using atomic force microscopy showed the existence of pili on the surface of M. tuberculosis in active and dormant states.[29] Similarly, in 2014, Fooladi et al. showed the morphology of pili by electron microscopy and tried to study pili gene expressions.[11] In the current study, we also showed pili in clinical isolates of M. tuberculosis. Our results showed the pili production in majority of both dormant and active isolates of TB [Table 2]. Therefore, we can conclude that M. tuberculosis is like other Gram-positive and Gram-negative bacteria species can produce pili [Figure 3].[6],[9],[34] However, how this pilus is playing the role of TB pathogenesis needs further investigation. It might be possible that M. tuberculosis can use the pili to exchange the biological material, to have crosstalk with other M. tuberculosis or even host cells that need in vitro and in vivo experimental research. We selected the two main genes that are responsible for production of pili in Gram-positive bacteria and M. tuberculosis. Generally, there are two kinds of pili, one curli pili encoded by (RV3312A) called mtp, and fimbrial low molecular weight protein encoded by (RV3656C) called flp, that considered as type IV pili.[6] We selected the specific regions in these two genes for analyzing the expression of pili genes. We found out that M. tuberculosis H37RV and clinical isolates in dormant and active states express these both genes [Figure 1]a and [Figure 1]b and [Figure 2]a, [Figure 2]b, [Figure 2]c, [Figure 2]d, [Figure 2]e, [Figure 2]f, [Figure 2]g. We designed specific primers based on point mutation with numbers 3701119: G ' A and 4095498: G ' A for mtp and flp genes, respectively. The mutations were analyzed at this region using primers which, to our knowledge, were used.

Additionally, we included a new restriction enzyme, for example, Fnu4HI for mtp and AciI for flp genes, respectively. Comparing with other restriction enzymes, our results showed that Fnu4HI and AciI are more sensitive to give a unique pattern in different isolates [Table 2].

Therefore, it might be better to use these enzymes for understanding the expression and existence of these genes.

Overall, the digested pattern in mtp and flp was almost similar in clinical and laboratory (H37Rv) isolates. However, 15% of isolates showed different patterns irrespective of the life cycle of M. tuberculosis. As already suggested by prof. Mitshison et al., 5%–10% of natural population of M. tuberculosis cannot be destroyed by any used drugs, they remained dormant in the host body.[2] Maybe these naturally populations of M. tuberculosis have other special genes or proteins which have not been investigated. This is mainly because the in vitro study of M. tuberculosis is not very easy. Although as latent TB effect 1.3 billion people of the world which at any time they can convert to active state, it is important to study TB bacilli at the dormant state.

Finally, based on our observation, we suggest that pili might play an important function in tuberculous strains that need more investigation.


  Conclusion Top


Understanding the physiological and molecular role of pili in TB pathogenesis would improve strategies for new achieving of drugs and treatment to M. tuberculosis that can destroy TB even in dormant states. Furthermore, we should answer whether pills can have a role in function and/or realizing nutrients materials during hardship state to M. tuberculosis in host cells. The present results can be considered for further studies to investigate the morphological and molecular changes in M. tuberculosis strains during dormancy to control their pathogenicity in this state properly.

Limitation of study

The low number of samples and the contamination of dormant cells that we had to repeat the experiments were quite problematic in the experiments. Furthermore, if we could do the same experiments in latent TB patients purified protein derivative (PPD positive cases) by using their bronchial lavage fluid and culturing their monocytes and macrophages, we could analyze the dormant TB in the host itself.

Ethical approval

The study protocol was approved by the Institutional Ethical Review Committee of Shahid Beheshti University of Medical Sciences (approval number: IR.SMU.NRITLD.REC.1397.565).

Consent to participate

In this study, informed consent was obtained from all subjects and/or their legal guardians prior to sample collection.

Acknowledgments

The authors would like to thank the National Research Institute of Tuberculosis and Lung Diseases, Masih Daneshvari Hospital, Shahid Beheshti University of Medical Sciences, and the Department of Microbiology affiliated to Islamic Azad University Branch of North Tehran for supporting this project.

Financial support and sponsorship

This work was supported by the National Research Institute of Tuberculosis and Lung Diseases, Masih Daneshvari Hospital, Shahid Beheshti University of Medical Sciences.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Brinton CC Jr. The structure, function, synthesis and genetic control of bacterial pili and a molecular model for DNA and RNA transport in gram negative bacteria. Trans N Y Acad Sci 1965;27:1003-54.  Back to cited text no. 1
    
2.
Canetti G, Froman S, Grosset J, Hauduroy P, Langerova M, Mahler HT, et al. Mycobacteria: Laboratory methods for testing drug sensitivity and resistance. Bull World Health Organ 1963;29:565-78.  Back to cited text no. 2
    
3.
Velayati AA, Farnia P, Masjedi MR. Pili in totally drug resistant Mycobacterium tuberculosis (TDR-TB). Int J Mycobacteriol 2012;1:57-8.  Back to cited text no. 3
  [Full text]  
4.
Perras AK, Wanner G, Klingl A, Mora M, Auerbach AK, Heinz V, et al. Grappling archaea: Ultrastructural analyses of an uncultivated, cold-loving archaeon, and its biofilm. Front Microbiol 2014;5:397.  Back to cited text no. 4
    
5.
Yanagawa R, Otsuki K, Tokui T. Electron microscopy of fine structure of Corynebacterium renale with special reference to pili. Jpn J Vet Res 1968;16:31-7.  Back to cited text no. 5
    
6.
Proft T, Baker EN. Pili in Gram-negative and Gram-positive bacteria – Structure, assembly and their role in disease. Cell Mol Life Sci 2009;66:613-35.  Back to cited text no. 6
    
7.
Alteri CJ. Novel Pili of Mycobacterium tuberculosis. The University of Arizona; 2005.  Back to cited text no. 7
    
8.
Ramsugit S, Pillay B, Pillay M. Evaluation of the role of Mycobacterium tuberculosis pili (MTP) as an adhesin, invasin, and cytokine inducer of epithelial cells. Braz J Infect Dis 2016;20:160-5.  Back to cited text no. 8
    
9.
Alteri CJ, Xicohténcatl-Cortes J, Hess S, Caballero-Olín G, Girón JA, Friedman RL. Mycobacterium tuberculosis produces pili during human infection. Proc Natl Acad Sci U S A 2007;104:5145-50.  Back to cited text no. 9
    
10.
Das PK, Ganguly SB, Mandal B. Cartridge-based nucleic acid amplification test (Xpert Mycobacterium tuberculosis/Rifampicin Assay): An essential molecular diagnostic test for early diagnosis and initiation of treatment in childhood tuberculous meningitis and primary multidrug-resistant cases. Biomed Biotechnol Res J (BBRJ) 2020;4:21.  Back to cited text no. 10
    
11.
Hosseini H, Fooladi AA, Arjomandzadegan M, Emami N, Bornasi H. Genetics study and transmission electron microscopy of pili in susceptible and resistant clinical isolates of Mycobacterium tuberculosis. Asian Pac J Trop Med 2014;7S1:S199-203.  Back to cited text no. 11
    
12.
Andersson M, Björnham O, Svantesson M, Badahdah A, Uhlin BE, Bullitt E. A structural basis for sustained bacterial adhesion: Biomechanical properties of CFA/I pili. J Mol Biol 2012;415:918-28.  Back to cited text no. 12
    
13.
Das PK, Ganguly SB, Mandal B. Early diagnosis of smear-negative childhood pulmonary tuberculosis and its substantial yield in gastric lavage/aspirates through cartridge-based nucleic acid amplification test (Xpert Mycobacterium tuberculosis/rifampicin assay). Biomed Biotechnol Res J (BBRJ) 2019;3:258.  Back to cited text no. 13
    
14.
Reedoy KS, Loots DT, Beukes D, Reenen MV, Pillay B, Pillay M. Mycobacterium tuberculosis curli pili (MTP) is associated with significant host metabolic pathways in an A549 epithelial cell infection model and contributes to the pathogenicity of Mycobacterium tuberculosis. Metabolomics 2020;16:116.  Back to cited text no. 14
    
15.
Sidiq Z, Hanif M, Chopra KK, Khanna A, Jadhav I, Dwivedi KK. Second-line drug susceptibilities of multidrug-and rifampicin-resistant Mycobacterium tuberculosis isolates in Delhi. Biomed Biotechnol Res J (BBRJ) 2019;3:87.  Back to cited text no. 15
    
16.
Zarzour H, Madania A, Ghoury I, Habous M. High-resolution genotyping of Mycobacterium tuberculosis isolates from Syria using mycobacterial interspersed repetitive unit-variable-number tandem repeat. Biomed Biotechnol Res J (BBRJ) 2019;3:1.  Back to cited text no. 16
    
17.
Assis Figueredo LJ, de Almeida IN, Augusto CJ, Soares VM, Suffys PN, Carvalho WD, et al. Characterization of Mycobacterium tuberculosis heteroresistance by genotyping. Int J Mycobacteriol 2020;9:368-72.  Back to cited text no. 17
    
18.
Velayati AA, Abeel T, Shea T, Konstantinovich Zhavnerko G, Birren B, Cassell GH, et al. Populations of latent Mycobacterium tuberculosis lack a cell wall: Isolation, visualization, and whole-genome characterization. Int J Mycobacteriol 2016;5:66-73.  Back to cited text no. 18
  [Full text]  
19.
Kuriki K, Taira J, Kuroki M, Sakamoto H, Aoki S. Computer-assisted screening of mycobacterial growth inhibitors: Exclusion of frequent hitters with the assistance of the multiple target screening method. Int J Mycobacteriol 2021;10:307-11.  Back to cited text no. 19
[PUBMED]  [Full text]  
20.
Bajrami R, Mulliqi G, Kurti A, Lila G, Raka L. Drug resistance profile of Mycobacterium tuberculosis isolates from patients referred to tuberculosis reference laboratory in Kosovo. Int J Mycobacteriol 2019;8:22-4.  Back to cited text no. 20
[PUBMED]  [Full text]  
21.
McEvoy CR, Falmer AA, Gey van Pittius NC, Victor TC, van Helden PD, Warren RM. The role of IS6110 in the evolution of Mycobacterium tuberculosis. Tuberculosis (Edinb) 2007;87:393-404.  Back to cited text no. 21
    
22.
Mirsaeidi MS, Tabarsi P, Farnia P, Ebrahimi G, Morris MW, Masjedi MR, et al. Trends of drug resistant Mycobacterium tuberculosis in a tertiary tuberculosis center in Iran. Saudi Med J 2007;28:544-50.  Back to cited text no. 22
    
23.
Singh S, Kumar M, Singh P. Evolution of M. bovis BCG vaccine: Is niacin production still a valid biomarker? Tuberc Res Treat 2015;2015:957519.  Back to cited text no. 23
    
24.
Velayati AA, Masjedi MR, Farnia P, Tabarsi P, Ghanavi J, ZiaZarifi AH, et al. Emergence of new forms of totally drug-resistant tuberculosis bacilli: Super extensively drug-resistant tuberculosis or totally drug-resistant strains in Iran. Chest 2009;136:420-5.  Back to cited text no. 24
    
25.
Maningi NE, Malinga LA, Antiabong JF, Lekalakala RM, Mbelle NM. Comparison of line probe assay to BACTEC MGIT 960 system for susceptibility testing of first and second-line anti-tuberculosis drugs in a referral laboratory in South Africa. BMC Infect Dis 2017;17:795.  Back to cited text no. 25
    
26.
Sheikh Ghomi S, Farnia P, Darbouy M. Detection of rpoB, inhA and katG genes mutations in clinical isolates of Mycobacterium tuberculosis by real-time PCR based on Taqman and HRM assays. J Ardabil Univ Med Sci 2014;14:147-57.  Back to cited text no. 26
    
27.
World Health Organization. (2001). Guidelines for drug susceptibility testing for second-line anti-tuberculosis drugs for DOTS-Plus (No. WHO/CDS/TB/2001.288). World Health Organization.  Back to cited text no. 27
    
28.
Wayne LG. Dormancy of Mycobacterium tuberculosis and latency of disease. Eur J Clin Microbiol Infect Dis 1994;13:908-14.  Back to cited text no. 28
    
29.
Velayati AA, Farnia P, Masjedi MR, Zhavnerko GK, Merza MA, Ghanavi J, et al. Sequential adaptation in latent tuberculosis bacilli: Observation by atomic force microscopy (AFM). Int J Clin Exp Med 2011;4:193-9.  Back to cited text no. 29
    
30.
Mohammadzadeh A, Farnia P, Rashed T, Ghazvini K, Behdani M, Ghanaat J. Use of alamar blue assay as a colorimetric method for detection of multidrug-resistant Mycobacterium tuberculosis. Horizon Med Sci 2007;13:47-51.  Back to cited text no. 30
    
31.
Evangelopoulos D and Bhakta S. Rapid methods for testing inhibitors of mycobacterial growth. In Antibiotic Resistance Protocols. Humana Press. 2010. pp. 193-201.  Back to cited text no. 31
    
32.
Vocat A, Hartkoorn RC, Lechartier B, Zhang M, Dhar N, Cole ST, et al. Bioluminescence for assessing drug potency against nonreplicating Mycobacterium tuberculosis. Antimicrob Agents Chemother 2015;59:4012-9.  Back to cited text no. 32
    
33.
Velayati AA, Farnia P, Ibrahim TA, Haroun RZ, Kuan HO, Ghanavi J, et al. Differences in cell wall thickness between resistant and nonresistant strains of Mycobacterium tuberculosis: Using transmission electron microscopy. Chemotherapy 2009;55:303-7.  Back to cited text no. 33
    
34.
Velayati AA, Farnia P. Atlas of Mycobacterium tuberculosis. Academic Press; 2016.  Back to cited text no. 34
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]
 
 
    Tables

  [Table 1], [Table 2]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed500    
    Printed46    
    Emailed0    
    PDF Downloaded66    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]